View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_low_37 (Length: 302)
Name: NF5311_low_37
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 37644176 - 37643902
Alignment:
| Q |
19 |
tatatcgcatagacaagaataaatcaatcatgcaaaatttgataaagaatttgttagctctcccttctcttttgttgattaatacctaccctttgaacca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37644176 |
tatatcgcatagacaagaataaatcaatcatgcaaaatttgataaagaattcgttagctctcccttcccttttgttgattaatacctaccctttgaacca |
37644077 |
T |
 |
| Q |
119 |
accgcagtgccgcaatccataaacccaaaaacgtattgtgccacatagtgccattaactgcatgtagactttttaccaaatctgcaataagagcatcaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37644076 |
accgcagtgccgcaatccataaacccaaaaacgtattgtgccacatagtgccattaactgcatgtagactttttaccaaatctgcaataagagcatcaaa |
37643977 |
T |
 |
| Q |
219 |
tatataattttaattcgaagagaagaattaaagaaacaagtagataannnnnnnnnatctatttcaaagtattat |
293 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37643976 |
tatataattttgattcgaagagaagaattaaagaaacaagtagataatttttttttatctatttcaaagtattat |
37643902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University