View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_low_42 (Length: 288)
Name: NF5311_low_42
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_low_42 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 25 - 288
Target Start/End: Complemental strand, 46146808 - 46146546
Alignment:
| Q |
25 |
gagatattttttgtgacacttatgatgcnnnnnnnnggctaatgaatggaacatatgtatgtagattgctgtgaagcggttgaagacaatgactgcaaaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46146808 |
gagatattttttgtgacacttatgatgcaaaaaat-ggctaatgaatggaacatatgtatgtagattgctgtgaagcggttgaagacaatgactgcaaaa |
46146710 |
T |
|
| Q |
125 |
gcagagatggaatttgcagttgaagtggaagtactaggaggggtgaggcataagaatttgttaggattgagggggttctatgcaggaggagatgaaaggt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46146709 |
gcagagatggaatttgcagttgaagtggaagtactaggaagggtgaggcataagaatttgttaggattgagggggttctatgcaggaggagatgaaaggt |
46146610 |
T |
|
| Q |
225 |
taattgtgtatgattacatgcctaatcatagcttgctcactcatttacatggtcaacttgcttc |
288 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46146609 |
taattgtgtatgattacatgtctaatcatagcttgctcactcatttacatggtcaacttgcttc |
46146546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 189
Target Start/End: Complemental strand, 53682821 - 53682752
Alignment:
| Q |
120 |
caaaagcagagatggaatttgcagttgaagtggaagtactaggaggggtgaggcataagaatttgttagg |
189 |
Q |
| |
|
|||| ||||||||||||||||| || ||||| ||||| || ||| |||| ||||| || ||||||||||| |
|
|
| T |
53682821 |
caaaggcagagatggaatttgctgtagaagttgaagtgcttggaagggttaggcacaaaaatttgttagg |
53682752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University