View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_low_45 (Length: 280)
Name: NF5311_low_45
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 35906942 - 35907026
Alignment:
| Q |
1 |
tgtagaaattacctacctggattggtggaacatgttccaaaccaggcaagaac-aaaaattaaggtgaagttttgattgttatta |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35906942 |
tgtagaaattacctacctggattggtggaacatgttccaaaccaggcaagaacaaaaaattaaggtgaagttttgattgttatta |
35907026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 35907149 - 35907201
Alignment:
| Q |
207 |
catgaacgttaagtttacatggttgagaagcagtgatagggagtgaggatcgt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35907149 |
catgaacgttaagtttacatggttgagaagcagtgatagggagtgaggatcgt |
35907201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University