View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_low_53 (Length: 252)
Name: NF5311_low_53
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 248
Target Start/End: Complemental strand, 48493631 - 48493393
Alignment:
| Q |
10 |
tcacagaggaattggcatttttgtccttgtgctaagcattcttcaggtatgccattgactcaatgttataatatataacaataatacttgcaaataacaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48493631 |
tcacagaggaattggcatttttgtccttgtgctaagcattcttcaggtatgccattgactcaatgttataatatataacaataatacttgcaaataacaa |
48493532 |
T |
|
| Q |
110 |
agtttagttctcacttatcatactgtcaagtacaattttaactggttaacgcttaaaagctgtgagattaatcacacaagtgtgttatttgcactactaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48493531 |
agtttagttctcacttatcatactgtcaagtacaattttaactggttaacgcttaaaagctgtgagattaatcacacaagtgtgttatttgcaccactaa |
48493432 |
T |
|
| Q |
210 |
aattaaactacttttgcgacaacaatctaaactcattaa |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48493431 |
aattaaactacttttgcgacaacaatctaaactcattaa |
48493393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University