View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_low_63 (Length: 239)
Name: NF5311_low_63
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 41245568 - 41245345
Alignment:
| Q |
1 |
ttttgcttgatttataagttgaaaattgatatttattttaaactccttatagtttttgtttatgtgagatctaagctaggtaaaataaccagattaatag |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41245568 |
ttttgtttgatttataagttgaaaattgatatttattttaaactccttatagtttttgtttatgtgagatctaagctaggtaaaataaccagattaatag |
41245469 |
T |
 |
| Q |
101 |
attaatattattgtttatagaataaaaaacttgataac--tctgnnnnnnnnatttgtctgttgtattactctaccaattttcaacatcaatgacctatt |
198 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41245468 |
attaatattattgtttatggaataaaaaacttgataactgtatgttttttttatttgtctgttgtattactctaccaattttcaacatcaatgatctatt |
41245369 |
T |
 |
| Q |
199 |
tgataccaacactttaggttgaat |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41245368 |
tgataccaacactttaggttgaat |
41245345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University