View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5311_low_67 (Length: 237)

Name: NF5311_low_67
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5311_low_67
NF5311_low_67
[»] chr7 (1 HSPs)
chr7 (1-224)||(48492927-48493150)


Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 48493150 - 48492927
Alignment:
1 cacaacttaaactgacttgaaaaccatgtgtgttcagatattggcattcttcttgagaccaaatagggattccaagtttcgcaaaatgtggaatttgtac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48493150 cacaacttaaactgacttgaaaaccatgtgtgttcagatattggcattcttcttgagaccaaatagggattccaagtttcgcaaaatgtggaatttgtac 48493051  T
101 cacagttggtttggaaggatggcactattctttgcagccttgaacatagtattgggaatgcaagctgcaggagcaacgaatgcttggaagacaagctatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48493050 cacagttggtttggaaggatggcactattctttgcagccttgaacatagtattgggaatgcaagctgcaggagcaacgaatgcttggaagacaagctatg 48492951  T
201 gattccttgctggtattataattg 224  Q
    ||||||||||||||||||||||||    
48492950 gattccttgctggtattataattg 48492927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University