View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_low_70 (Length: 228)
Name: NF5311_low_70
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 7089560 - 7089341
Alignment:
| Q |
1 |
tctgttatttattatacaataaagttgagggtgtccccatgaacttaactcaattgatatgtaatatacaagtgctgaagttcaaaccccaaacaaagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||| ||| | | |
|
|
| T |
7089560 |
tctgttatttattatacaataaagttgagggtgtccccatgagcttaactcaattggtctgtaatatacaagtgctgaagttcaaaccccgaac--accc |
7089463 |
T |
 |
| Q |
101 |
caaacaacgcttacatatatactcacaaatactcatcaacaaaattctaatattgacaacgagaattgaactcacatc-gtgtaaagggtttgaaactac |
199 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
7089462 |
caaacaaagcttacatatatactcacaaatactcatcaacaaaatcctaatattgacaacgagaattgaactcacatcggtgcaaaggatttgaaactac |
7089363 |
T |
 |
| Q |
200 |
ttacacatatataacaaataaa |
221 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
7089362 |
ttacacatatacaacaaataaa |
7089341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University