View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_low_72 (Length: 226)
Name: NF5311_low_72
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_low_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 8727420 - 8727327
Alignment:
| Q |
10 |
agtgagatgaacagttttcttctctttgttattgggggaaatcagcccaacccagcaaatataagttatgcagactaatgaaacagtccgacca |
103 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
8727420 |
agtgagatgaacaatttccttctctttgttattgggggaaatcagcccaacccaacaaatataagttatgcagactaatgaatcagcccgacca |
8727327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 169 - 210
Target Start/End: Complemental strand, 8727262 - 8727221
Alignment:
| Q |
169 |
cccaacacactttgctcgcgcccaattgaaataccaaaaata |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8727262 |
cccaacacactttgctcgcgcccaactgaaataccaaaaata |
8727221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 169 - 210
Target Start/End: Complemental strand, 7269345 - 7269304
Alignment:
| Q |
169 |
cccaacacactttgctcgcgcccaattgaaataccaaaaata |
210 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||| |||||| |
|
|
| T |
7269345 |
cccaacacattttgctcgcgcccaactgaaataccgaaaata |
7269304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 211
Target Start/End: Original strand, 9883064 - 9883096
Alignment:
| Q |
179 |
tttgctcgcgcccaattgaaataccaaaaatat |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
9883064 |
tttgctcgcgcccaattgaaatatcaaaaatat |
9883096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University