View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5311_low_74 (Length: 222)

Name: NF5311_low_74
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5311_low_74
NF5311_low_74
[»] chr7 (1 HSPs)
chr7 (8-219)||(40230456-40230667)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 8 - 219
Target Start/End: Complemental strand, 40230667 - 40230456
Alignment:
8 aatgttttatgattgtctggttatgaaatcatatgtctgtctgattgatcttttagaataattgatcatcttaatttcgcaaacgacaataatttgatta 107  Q
    ||||||||||||||||||| |||| || | |||||||  ||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
40230667 aatgttttatgattgtctgattattaacttatatgtcgctctgactgatcttttagaataattgatcatcttaatttcgcaatcgacaataatttgatta 40230568  T
108 ttcaattagatgaaaggtatataaaacgtgtcactcgtatactcaattttttatgtgacccatatactcaattttgtctatgttttgcattttgtttatt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40230567 ttcaattagatgaaaggtatataaaacgtgtcactcgtatactcaattttttatgtgacccatatactcaattttgtctatgttttgcattttgtttatt 40230468  T
208 aacccgtatatt 219  Q
    ||||||||||||    
40230467 aacccgtatatt 40230456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University