View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5311_low_77 (Length: 204)

Name: NF5311_low_77
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5311_low_77
NF5311_low_77
[»] chr4 (1 HSPs)
chr4 (19-150)||(38512128-38512259)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 19 - 150
Target Start/End: Original strand, 38512128 - 38512259
Alignment:
19 tataagtaggagtttcagtaaaggtgttaaaacttaaaatagtgaaaggcttaaaacgatacatttcatatttgacgagttcattagttcgtactaagct 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38512128 tataagtaggagtttcagtaaaggtgttaaaacttaaaatagtgaaaggcttaaaacgatacatttcatatttgacgagttcattagttcgtactaagct 38512227  T
119 cacatgtgatgttgctggatcagtagtgtctt 150  Q
    ||||||||||||||||||||||||||||||||    
38512228 cacatgtgatgttgctggatcagtagtgtctt 38512259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University