View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_low_78 (Length: 202)
Name: NF5311_low_78
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 8e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 59 - 184
Target Start/End: Original strand, 27639563 - 27639688
Alignment:
| Q |
59 |
tatatcaattgcacaatggtgcaatgcacctttagaagctatgtagtttaatacgttatagtttttagacaaaatcaatgaacaatctaatccataactc |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27639563 |
tatatcaattgcacaatggtgcaatgcacctttagaagctatgtattttaatacgttatagtttttagacaaaatcaatgaacaatctaatccataactc |
27639662 |
T |
|
| Q |
159 |
aagaatgatacattaagtaggtaaat |
184 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
27639663 |
aagaatgatacattaagtaggtaaat |
27639688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University