View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_high_36 (Length: 313)
Name: NF5312_high_36
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_high_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 10 - 301
Target Start/End: Complemental strand, 1420076 - 1419787
Alignment:
| Q |
10 |
agacgccaaaccaaacaattttacggatagaaggatgatccagctttttactgataattggaagaaaccagctccaagctgtttcaaatgcagcatcgat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1420076 |
agacgccaaaccaaacaattttacggatagaagtatgatccagctttttactgataattggaagaaaccagctccaagctgtttcaaatgcagcatcgat |
1419977 |
T |
 |
| Q |
110 |
gcctctttctcagctcaaattaatagtgggaattgaaatttgcataagagatgataacgcaattctgtacattttaaagtagtaaaacataagcacattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
1419976 |
gcctctttctcagctcaaattaatagtgggaattgaaatttgcataagagatgataacacaattttgtacatgttaaagtagtacaacataagcacattt |
1419877 |
T |
 |
| Q |
210 |
tgatgcccctaaaggaagattggtgctgccagattagatnnnnnnnnnncaattcttgaataagctattcaactccaaggatgtgtgcgcgc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1419876 |
tgatgcccctaaaggaagattggtgctgccagattagat--aaaaaaaacaattcttgaataagatattcaactccaaggatgtgtgcgcgc |
1419787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University