View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_high_56 (Length: 248)
Name: NF5312_high_56
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_high_56 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 28690619 - 28690861
Alignment:
| Q |
1 |
ggagtagcataggaacttggaccctttttcccccaaaatagcagccaacctaagctcaagttgaacccatattcttggaataaaggtgggtcaatttc-- |
98 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28690619 |
ggagaagcagaggaacttggaccctttttcccccaaaatagcagccaacctaagctcaagttgaacccatattcttggaataaaggtgggtcaatttcaa |
28690718 |
T |
 |
| Q |
99 |
-aaattgataactttcacaatgcattgcaataatggtagttcaattcattgtaaatttgttaatttgagataaactttgtatatcctgtacaattttaaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28690719 |
taaattgataactttcacaatgcattgcaaaaatggtagttcaattcattgta--------aatttgagataaactttgtatatcttgtacaattttaaa |
28690810 |
T |
 |
| Q |
198 |
aataaactaaatcttttctacagctgcaaatcttttgtttcttgaatcccc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28690811 |
aataaactaaatcttttctacagctgcaaatcttttgtttcttgaatcccc |
28690861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University