View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_high_60 (Length: 243)
Name: NF5312_high_60
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_high_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 6 - 84
Target Start/End: Complemental strand, 508481 - 508403
Alignment:
| Q |
6 |
ttaaatacaactattttctttgcaacttaattgtctcgtgtgaatctgaaattatcaaattatttaggaggggtgtgcc |
84 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
508481 |
ttaaatacaactattttctttgcaagttaattgtctcgtgtgaatctgaaattatcaaattatttaggaggggtgtgcc |
508403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 132 - 183
Target Start/End: Complemental strand, 508282 - 508231
Alignment:
| Q |
132 |
gacatgtaatctacctttgtctccaaggtctaaaacgttttcatcaaagatg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
508282 |
gacatgtaatctacctttgtctccaaggtctaaaacgttttcatcaaagatg |
508231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University