View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_high_64 (Length: 239)
Name: NF5312_high_64
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_high_64 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 66 - 239
Target Start/End: Complemental strand, 508752 - 508579
Alignment:
| Q |
66 |
cccgattgttgtttaacacaatgaaatccaaatataaaaatacttgaagtagccacaaatttaacatgttatcgaaaaatctaaatttctcttgattgat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
508752 |
cccgattgttgtttaacacaatgaaatcgaaatataaaaatacttgaagtagccacaaatttaacatgttatcgaaaaatctaaatttgtcttgattgat |
508653 |
T |
|
| Q |
166 |
gataaacacaaacaaagacaggtttgtttgttaccgtacgtgagtttctttgtaacttttgcatatagctatat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
508652 |
cataaacacaaacaaagacaggtttgtttgttaccgtacgtgagtttctttgtaacttttgcatatagctatat |
508579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University