View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_high_67 (Length: 237)
Name: NF5312_high_67
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_high_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 2337816 - 2338037
Alignment:
| Q |
1 |
aggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttctctggtattagtactgtctaacaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2337816 |
aggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttctctggtattagtactgtctaacaatc |
2337915 |
T |
|
| Q |
101 |
aaattgacatagaatattattacttctaatcacttgatcattgtgagatgtgccgtgtttgcttcgttcatttcaacattccaatgtcatttgtcaatcg |
200 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2337916 |
aaattgatatagtatattattacttctaatcacttgatcattatgagatgtgccgtgtttgcttcgtttatttcaacattccaatgtcatttgtcaatcg |
2338015 |
T |
|
| Q |
201 |
ttgcccgctgttctttcttctt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2338016 |
ttgcccgctgttctttcttctt |
2338037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 2344698 - 2344773
Alignment:
| Q |
1 |
aggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttctc |
76 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| ||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
2344698 |
aggctggttggtgttggagaggcttcgtttataagtctagcagcaccttttattgatgacaatgccccagcttctc |
2344773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 2324562 - 2324626
Alignment:
| Q |
4 |
ctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgcccc |
68 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2324562 |
ctggttggtgttggtgaggcatcgtttataagtttagcagcccctttcattgatgacaacgcccc |
2324626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 36798561 - 36798488
Alignment:
| Q |
1 |
aggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttc |
74 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||| | ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
36798561 |
aggctcgttggtgttggcgaggcttcatttataagtcttgcagcacctttcattgatgataacgccccagcttc |
36798488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University