View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5312_high_67 (Length: 237)

Name: NF5312_high_67
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5312_high_67
NF5312_high_67
[»] chr2 (3 HSPs)
chr2 (1-222)||(2337816-2338037)
chr2 (1-76)||(2344698-2344773)
chr2 (4-68)||(2324562-2324626)
[»] chr4 (1 HSPs)
chr4 (1-74)||(36798488-36798561)


Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 2337816 - 2338037
Alignment:
1 aggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttctctggtattagtactgtctaacaatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2337816 aggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttctctggtattagtactgtctaacaatc 2337915  T
101 aaattgacatagaatattattacttctaatcacttgatcattgtgagatgtgccgtgtttgcttcgttcatttcaacattccaatgtcatttgtcaatcg 200  Q
    ||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
2337916 aaattgatatagtatattattacttctaatcacttgatcattatgagatgtgccgtgtttgcttcgtttatttcaacattccaatgtcatttgtcaatcg 2338015  T
201 ttgcccgctgttctttcttctt 222  Q
    ||||||||||||||||||||||    
2338016 ttgcccgctgttctttcttctt 2338037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 2344698 - 2344773
Alignment:
1 aggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttctc 76  Q
    ||||||||||||||||| |||||||||||||||||| ||||| ||||||| ||||||||||| ||||| |||||||    
2344698 aggctggttggtgttggagaggcttcgtttataagtctagcagcaccttttattgatgacaatgccccagcttctc 2344773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 2324562 - 2324626
Alignment:
4 ctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgcccc 68  Q
    |||||||||||||| ||||| |||||||||||||||||| | |||||||||||||||||||||||    
2324562 ctggttggtgttggtgaggcatcgtttataagtttagcagcccctttcattgatgacaacgcccc 2324626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 36798561 - 36798488
Alignment:
1 aggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttc 74  Q
    ||||| |||||||||||||||||||| ||||||||| | ||| |||||||||||||||| |||||||| |||||    
36798561 aggctcgttggtgttggcgaggcttcatttataagtcttgcagcacctttcattgatgataacgccccagcttc 36798488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University