View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_high_68 (Length: 236)
Name: NF5312_high_68
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 13923068 - 13922843
Alignment:
| Q |
1 |
aaaaaggtggtgccttagacttgaggccgatatgatcaccataatttaannnnnnnncttatagatacgagaattaatcctcaat-----tcattaattc |
95 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| || |||||||||||| |||||||||||||||||||||||| | | | |||||||| |
|
|
| T |
13923068 |
aaaaaggtggtgtcgtagacttgaggccgatacaatgaccataatttaattttttt-cttatagatacgagaattaatccttattaatccttattaattc |
13922970 |
T |
 |
| Q |
96 |
tctttggtaaatgtcataggggtcttcttcgctcaaaaagattttttcatttggttttatcccctctctatgtaac-nnnnnnnnctttttccgtttagg |
194 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
13922969 |
tctttggtaaatgtcataggagtcttcttcgctcaaaaagattctttcatttggttttatcccctctctttgtaacaaaaaaaaactttttcagtttagg |
13922870 |
T |
 |
| Q |
195 |
gtaaactaaaaaatatatagatttttc |
221 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
13922869 |
gtaaactaaaaaatatatagatttttc |
13922843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University