View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_high_77 (Length: 220)
Name: NF5312_high_77
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_high_77 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 24 - 206
Target Start/End: Original strand, 10251847 - 10252025
Alignment:
| Q |
24 |
gaaattaagaaactgttttatttgacatggacacaggaatgcataatataactcactgatattttgtagttccaattggtttttatttatccaaaagaaa |
123 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251847 |
gaaattaagaaactgttttgtttgacatggacacaggaatgcataatataactcactgatattttgtagttccaattggtttttatttatccaaaagaaa |
10251946 |
T |
 |
| Q |
124 |
atactttgtatattaattccatacattgtggataaattgttgtcttatgtacctcaaacaaaattgaaatcgggcaatatgtg |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251947 |
atactttgtatattaattc----cattgtggataaattgttgtcttatgtacctcaaacaaaattgaaatcgggcaatatgtg |
10252025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University