View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_29 (Length: 339)
Name: NF5312_low_29
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 29231786 - 29231919
Alignment:
| Q |
1 |
caattacaggcaatatattgttggtacatgttatggatgattattgtctaaaatctatttgaaatcagtctgaaaattacatttttctggcagtggcttc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29231786 |
caattacaggcaatatattggaggtacatgttatggatgattattgtctaaaatctatttgaaatcagtctgaaaattacatttttctggcagtggcttc |
29231885 |
T |
|
| Q |
101 |
tttaatttacattttaccatttatctaaaaatta |
134 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
29231886 |
tttaatttacattttaccgtttatctaaaaatta |
29231919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 205 - 332
Target Start/End: Original strand, 29231995 - 29232124
Alignment:
| Q |
205 |
gccctgcataaaatttatgccaactcaatcaccgactata--taatatagctaggaataaattgatgtcacattgccctaagacctagatcaaatagtaa |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
29231995 |
gccctgcataaaatttatgccaactcaatcaccgactatatataatatagctaggaataaattgatgtcgcatttccctaagacctagatcaaatagtaa |
29232094 |
T |
|
| Q |
303 |
tatcaaaattgttaggctgaatattcttcg |
332 |
Q |
| |
|
|||||||||||||| |||||||||| |||| |
|
|
| T |
29232095 |
tatcaaaattgttaagctgaatatttttcg |
29232124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University