View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_39 (Length: 315)
Name: NF5312_low_39
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 16 - 298
Target Start/End: Complemental strand, 39784048 - 39783766
Alignment:
| Q |
16 |
attctgcaaccccagtgagtttttaatagctgatcaatacaatcaggaaattttaaaattaactctattttgtttgtaacacctatcacattgcccaaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39784048 |
attctgcaaccccagtgagtttttaatagctgatcaatacaatcaggaaattttaaaattaactctattttgtttgtaacacccatcacattgcccaaca |
39783949 |
T |
 |
| Q |
116 |
gggatatggagacaaatgcagtacagatattaagatataaaatgaataatcaacccaataacacagcagacaaaatttaaaatttcaccgagagttattt |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39783948 |
gggatatagagacaaatgcagtacagatattaagatataaaatgaataatcaacccaataacacagcagacaaaatttaaaatttcaccgggagttattt |
39783849 |
T |
 |
| Q |
216 |
tattggaagattaaaggcagtacataatggtaccaaaggaaattccagtcattgtctacagctggaaatacataaaatgaata |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783848 |
tattggaagattaaaggcagtacataatggtaccaaaggaaattccagtcattgtctacagctggaaatacataaaatgaata |
39783766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University