View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_47 (Length: 287)
Name: NF5312_low_47
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 164 - 259
Target Start/End: Original strand, 31261593 - 31261688
Alignment:
| Q |
164 |
catcacatcactcaatcacaacaagtgcactctttctctctctgnnnnnnnncccctataaaatcttcatcactcactcataaatttccctcgtaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261593 |
catcacatcactcaatcacaacaagtgccctctttctctctctgttttttttcccctataaaatcttcatcactcactcataaatttccctcgtaa |
31261688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 31261431 - 31261513
Alignment:
| Q |
1 |
tgtgtcacaatgtctatcttctcaaacacttattatgaatgagttttataattaaatttattgaaataagaaaaagaacaatac |
84 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31261431 |
tgtgtcacaatgtctatcttctcaa-cacttattgtgaatgagttttatcattaaatttattgaaataaaaaaaagaacaatac |
31261513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University