View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_49 (Length: 282)
Name: NF5312_low_49
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 576557 - 576812
Alignment:
| Q |
19 |
acacctctcatgccaaaccggacttttgagacgtatatttttgctttgtttgatgaaaatctaaagcctggtccaatatgtgaaaggaatttcgggttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
576557 |
acacctctcatgccaaaccggacttttgagacatatatttttgctttgtttgatgaaaatctaaagcccggtccaatatgtgaaaggaattttgggttgt |
576656 |
T |
|
| Q |
119 |
tccgacccaatatgactcttgtctatgatg---tcccaataatgagaaaaaatgtagctgttgctaacagtcattctaaagcaatattgtcattcatgac |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
576657 |
tccgacccaacatgactcttgtctatgatgacgtcccaataatgagaaaaaatgtagctgttgctaacagtcattctaaagcaatattgtcattcatgac |
576756 |
T |
|
| Q |
216 |
agccttgagcttcttgattggttggtggacttaaattttgttggctcattgttcat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
576757 |
agccttgagcttcttgattggttggtggacttaaattttgttggctcattgttcat |
576812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University