View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_50 (Length: 279)
Name: NF5312_low_50
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 16 - 263
Target Start/End: Complemental strand, 39752658 - 39752411
Alignment:
| Q |
16 |
gtaatttttatggtaacatttggtttttcattctgcaatgattatgtattcattcatcaagttcaaagtatctttttaagcacctcacttaatttggagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39752658 |
gtaatttttatggtaacatttggtttctcattctgcaatgattatgtattcattcattaggttcaaagtatctttttaagcacctcacttaatttggagg |
39752559 |
T |
|
| Q |
116 |
tttagaaggcgaatctagaatatttcaatcttttcttcaattaatttgagtattgtgaaatgagtcatctctaaatcagttatttgataaagtgaagttt |
215 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39752558 |
tttaggaggcgaatctagaatatttcaatgttttcttcaattgatttgagtattgtgaaatgagtcatctctaaatcagttatttgataaagtgaagatt |
39752459 |
T |
|
| Q |
216 |
ttatccttttggttgtttaaagctaaaacgaaaacttagctagagttt |
263 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39752458 |
ttatccttttgtttgtttaaagctaaaacgaaaacttagctagagttt |
39752411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University