View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_57 (Length: 254)
Name: NF5312_low_57
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 23 - 241
Target Start/End: Complemental strand, 44973744 - 44973530
Alignment:
| Q |
23 |
gtataacgttggtgtggatgataaagagagacaaaaataaaggaataattaaaaatgttttgtaccttttggtggttgcattattatcctactatttttc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44973744 |
gtataacgttggtgtggatgataaagagagacaaaaataaaggaataattaaaaatgttttgtaccttttggtggttgcattattatcctactatttttc |
44973645 |
T |
 |
| Q |
123 |
ctatcatggaattatactgtattacaagcaatcagcacttatatatatagtccgtgagccttttgtgtttataaatgcaaaaatgatatacattttattt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
44973644 |
ctatcatggaattatactgtattacaagcaatcagcactta----tatagtccgtgagccttttgtgtttataaatgcaacaatcatatacattttattt |
44973549 |
T |
 |
| Q |
223 |
aacaactcattattttctt |
241 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44973548 |
aacaactcattattttctt |
44973530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University