View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_63 (Length: 248)
Name: NF5312_low_63
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 24329407 - 24329165
Alignment:
| Q |
1 |
gtttacaaacatgattattatttatgattatgtaacaaataaccgcggtaaattttatcattgttttggaattattaaggttctgacattctgttcatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24329407 |
gtttacaaacatgattattatttatgattatgtaacaaataaccgcggtaaatttaatcattgttttggaattattaaggttctgacattctgttcatat |
24329308 |
T |
|
| Q |
101 |
tcagaaaatattgagacattgagaatttcagttgttgttttcaattaaaaaatgacaaaatcttaaagaagcacgaggagaaagctcattctcactgtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24329307 |
tcagaaaatattgagacattgagaattttagttgttgttttcaattagaaaatgacaaaatcttaaagaagcacgaggagaaagctcattctcactgtat |
24329208 |
T |
|
| Q |
201 |
caaagcttttttgtaggggacacaaccaatattactctctgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24329207 |
caaagcttttttgtaggggacacaaccaatattactctctgct |
24329165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University