View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_65 (Length: 247)
Name: NF5312_low_65
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 31572788 - 31572911
Alignment:
| Q |
1 |
ctattgaaccaccaagcaagagtttctcactactacatatacttgacatttagtaacacatttatgtaacgaagaaaaatataattactatttaaccatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31572788 |
ctattgaaccaccaagcaagagtttctcactactacatatacttgacatttagtaacacatttatgtaacgaagaaaaatataattactatttaaccatt |
31572887 |
T |
 |
| Q |
101 |
tttaggacgagaatagcatcttct |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31572888 |
tttaggacgagaatagcatcttct |
31572911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 28746411 - 28746441
Alignment:
| Q |
1 |
ctattgaaccaccaagcaagagtttctcact |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28746411 |
ctattgaaccaccaagcaagagtttctcact |
28746441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 107
Target Start/End: Original strand, 19842896 - 19842964
Alignment:
| Q |
39 |
atacttgacatttagtaacacatttatgtaacgaagaaaaatataattactatttaaccatttttagga |
107 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||| || ||||| |||||| ||| |||||| |
|
|
| T |
19842896 |
atacttgacatttagtaacacaggtgtgtaacgaagaaaataattgttactgtttaacaattattagga |
19842964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University