View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_66 (Length: 245)
Name: NF5312_low_66
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_66 |
 | |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 28080547 - 28080782
Alignment:
| Q |
10 |
acatcatcattgatgacattgttatctactgcataatcagaaacatgatgcaattgtagagttggtgtcccttgataggataagtgtggatacaaattct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28080547 |
acatcatcattgatgacattgttatctactgcataatcagaaacatgatgcaattgtagagttggtgtcccttgataggataagtgtggatacaaattct |
28080646 |
T |
|
| Q |
110 |
tgttgccaatactcatcatattcgagtgttgagaaatatcaatgagaggatcaaccggaaaattgatagtacctgtagaatcattcatatgaagtaacga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28080647 |
tgttgccaatactcatcatattcgagtgttgagaaatatcaatgagaggatcaaccggaaaattgatagtacctgtagaatcattcatatgaagtaacga |
28080746 |
T |
|
| Q |
210 |
tcgctggtcaaaagattggcaatgtcttgaactgtt |
245 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28080747 |
tcgctggtcaaaagatcggcaatgtcttgaactgtt |
28080782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 208 - 245
Target Start/End: Original strand, 28080871 - 28080908
Alignment:
| Q |
208 |
gatcgctggtcaaaagattggcaatgtcttgaactgtt |
245 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28080871 |
gatcgctggtcaaaagattggcgatgtcttgaactgtt |
28080908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 208 - 245
Target Start/End: Original strand, 28080934 - 28080971
Alignment:
| Q |
208 |
gatcgctggtcaaaagattggcaatgtcttgaactgtt |
245 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28080934 |
gatcgctggtcaaaagattggcgatgtcttgaactgtt |
28080971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 245
Target Start/End: Original strand, 28080804 - 28080845
Alignment:
| Q |
204 |
taacgatcgctggtcaaaagattggcaatgtcttgaactgtt |
245 |
Q |
| |
|
||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
28080804 |
taacgattgctgttcaaaaggttggcaatgtcttgaactgtt |
28080845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University