View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_70 (Length: 239)
Name: NF5312_low_70
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 32 - 214
Target Start/End: Complemental strand, 24329816 - 24329633
Alignment:
| Q |
32 |
gatacaagtgtgaataagagttttatattgaatgaaataatgcatgttgaacaacatatgaatacgatgattcacatgtctaatagtttaattaagactt |
131 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||| |
|
|
| T |
24329816 |
gatacaagtgtgaataagagttttacattgaatgaaataatgcatgttgaacaacatatgaatacgatgattcacatgcctaataatttaattagaactt |
24329717 |
T |
 |
| Q |
132 |
tggatcaaaatataagctttaa-tcacttgtatgtttgctcttacaacaatgtagaatttatctatttcagtcgtcattgtcgc |
214 |
Q |
| |
|
||| |||||||| || ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24329716 |
tgggtcaaaatacgaggtttaattcacttgtatggttgctcttacaacaatgtagaatttatctatttcagttgtcattgtcgc |
24329633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University