View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_71 (Length: 239)
Name: NF5312_low_71
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_71 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 24773610 - 24773380
Alignment:
| Q |
9 |
acatcatcatattgaagtgcagacatggcagcattaaccgcgtcgatttgtgcgtcgaagagattatcatatttcaaatgattaccagaatcaacaacac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24773610 |
acatcatcatattgaagtgcagacatggcagcattaacggcgtcgatttgagcgtccaaaagattatcatatttcaaatgattaccagaatcaataacac |
24773511 |
T |
 |
| Q |
109 |
cagggttttgcttaaacaaagcataatctaatgagattgtgtctgagttagcagcataagcnnnnnnnggataagcgttaacaattaaagaagaaccgga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
24773510 |
cagggttttgcttaaacaaagcataatctaatgagattgtgtctgagttagcagcataagcaaaaaaaggataagcgttaaccattaaataagaaccggt |
24773411 |
T |
 |
| Q |
209 |
ttgacgtagaaactcgagaatcggtttaata |
239 |
Q |
| |
|
||||| |||||||||||| |||||||||||| |
|
|
| T |
24773410 |
ttgacttagaaactcgagcatcggtttaata |
24773380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University