View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_72 (Length: 239)
Name: NF5312_low_72
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_72 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 67 - 224
Target Start/End: Original strand, 30434894 - 30435060
Alignment:
| Q |
67 |
tttataggaataaatttatgtgattgcatatttgtact---------aacaaaatatatttataccttcttatatattcatctatattctatcaaagtaa |
157 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30434894 |
tttataggaataaattcatgtgattgcatatttgtacttttgtagagaacaaaataaatttataccttcttatatattcatctatattctatcaaagtaa |
30434993 |
T |
|
| Q |
158 |
agattagttttgtagaaaatatcataccaaaccatgacggtcgaaggtagagcaagtttgagaaatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30434994 |
agattagttttgtagaaaatatcataccaaaccatgacggtcgaaggtagagcaagtttgagaaatt |
30435060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 105 - 224
Target Start/End: Original strand, 30419635 - 30419754
Alignment:
| Q |
105 |
aacaaaatatatttataccttcttatatattcatctatattctatcaaagtaaagattagttttgtagaaaatatcataccaaaccatgacggtcgaagg |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||| ||||||| |||| |||||||||||||| | |||||| |
|
|
| T |
30419635 |
aacaaaatatatttaaaccttcttatataatcatctatattctatcaaagtaaattttagtttagtagaaattatcttaccaaaccatgactgccgaagg |
30419734 |
T |
|
| Q |
205 |
tagagcaagtttgagaaatt |
224 |
Q |
| |
|
| || ||||||||||||| |
|
|
| T |
30419735 |
aaatgcgagtttgagaaatt |
30419754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University