View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_83 (Length: 226)
Name: NF5312_low_83
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 27958492 - 27958696
Alignment:
| Q |
12 |
atcatcagcctttccaaagttaactttaacaaggatggcc----ttatttcaggttatggtcttcaaatctttgaatgcaataagaactaaaaaccccac |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27958492 |
atcataagcctttccaaagttaactttaacaaggatggtcggtcttattccaggttatggtcttcaaatctttgaatgcaataagaactaaaaatcccac |
27958591 |
T |
 |
| Q |
108 |
ctataaatataagtcaaagattttgcattgggtttggaatttatagtccaaatcacatcttgaattcaaatacaactaggagactccttattcacaaaca |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27958592 |
ctataaatataagtcaaagattttacattgggtttggaatttatagtccaaatcacatcttgaattcaaatacaactaggagactccttattaacaaaca |
27958691 |
T |
 |
| Q |
208 |
ataat |
212 |
Q |
| |
|
||||| |
|
|
| T |
27958692 |
ataat |
27958696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 113
Target Start/End: Complemental strand, 16331020 - 16330984
Alignment:
| Q |
77 |
ctttgaatgcaataagaactaaaaaccccacctataa |
113 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16331020 |
ctttgaatgcaataagaaataaaaaccccacctataa |
16330984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University