View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_87 (Length: 218)
Name: NF5312_low_87
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_87 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 29525321 - 29525118
Alignment:
| Q |
1 |
tactgaattttcttcaagtataatgtctactacaccttgatcacttccacaactagcaacttctggtatggtaactgaactgtcaataacttgaccttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29525321 |
tactgaattttcttcaagtataatgtctactacaccttgatcacttccacaactagcaacttctggtatggtaactgaactgtcaataacttgaccttca |
29525222 |
T |
 |
| Q |
101 |
ctagatacctcttgttggtaatctagatatgaatcaataataacacgactttcatgggcaacatctggttgacctgtattaccaacctctggatcagaac |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29525221 |
ctagatacctcttgttggttatctagatatgaatcaataataacacgactttcatgggcaacatctggttgaactgtattaccaacctctggatcagaac |
29525122 |
T |
 |
| Q |
201 |
ctga |
204 |
Q |
| |
|
|||| |
|
|
| T |
29525121 |
ctga |
29525118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 85 - 204
Target Start/End: Complemental strand, 29613035 - 29612907
Alignment:
| Q |
85 |
aataacttgaccttcactagatacctcttgttggtaatctagatatgaatcaataataac---acgactttcatgg------gcaacatctggttgacct |
175 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||| ||||| ||||||| ||||||||||| || | |||| | | ||||||||||||||||| |
|
|
| T |
29613035 |
aatatcttgaccttcactagatacctctttttggcaatctggatatgactcaataataacttgactaatttcgttgccaacatcaacatctggttgacct |
29612936 |
T |
 |
| Q |
176 |
gtattaccaacctctggatcagaacctga |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29612935 |
acattaccaacctctggatcagaacctga |
29612907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University