View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_90 (Length: 213)
Name: NF5312_low_90
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_90 |
 | |
|
| [»] chr4 (4 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 41483441 - 41483245
Alignment:
| Q |
17 |
cacttacccttctacatgagacacatcctcccacacctgaggttgcttcaacttctctttgcatatctttaaatatgaatgtttaagtcattaattatac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41483441 |
cacttacccttctacatgagacacatcctcccacacctgaggttgcttcaacttctctttgcatatctttaaatatgaatgtttaagtcattaattatac |
41483342 |
T |
|
| Q |
117 |
aaatactaactttaaacataaactatattaaaggaaagatgtgaacctgtagtcctggaacaccattggtgattaggagagtgatcatgccataatc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41483341 |
aaatactaactttaaacataaactatattaaaggaaagatgtgaacctgtagtcctggaacaccattggtgattaggagagtgatcatgccataatc |
41483245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 41491314 - 41491221
Alignment:
| Q |
18 |
acttacccttctacatgagacacatcctcccacacctgaggttgcttcaacttctctttgcatatctttaaatatgaatgtttaagtcattaat |
111 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| |||||||||||||| ||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
41491314 |
acttacccttctacatgagaaacatcctcccatacctgaggctgcttcaacttctccttgcagatctttaaatataaattcttaagtcattaat |
41491221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 152 - 213
Target Start/End: Complemental strand, 41497385 - 41497324
Alignment:
| Q |
152 |
aagatgtgaacctgtagtcctggaacaccattggtgattaggagagtgatcatgccataatc |
213 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
41497385 |
aagatgagaacctgcagtcctggaacaccgttggtcaataggagagtgatcatgccataatc |
41497324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 41491145 - 41491091
Alignment:
| Q |
159 |
gaacctgtagtcctggaacaccattggtgattaggagagtgatcatgccataatc |
213 |
Q |
| |
|
||||||| |||||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
41491145 |
gaacctgcagtcctggaacaccgttggttaataggagagtgatcatgccataatc |
41491091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University