View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5312_low_92 (Length: 210)
Name: NF5312_low_92
Description: NF5312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5312_low_92 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 28 - 192
Target Start/End: Complemental strand, 24773442 - 24773278
Alignment:
| Q |
28 |
ggataagcgttaaccattaaataagaaccggtttgacgtagaaactcgagcatcggtttaataactggttcaacaagttcggttttgaatgaaccggatg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| || |
|
|
| T |
24773442 |
ggataagcgttaaccattaaataagaaccggtttgacttagaaactcgagcatcggtttaataaccggttcaacaagttcagttttgaatgaaccggttg |
24773343 |
T |
|
| Q |
128 |
aggtagggtaagaagattgtaaagcagagagtgctatgggtgaagagattaaaatctgtttatct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
24773342 |
aggtagggtaagaagattgtaaagcagagagagctattggtgaagagattaaaatctgtttatct |
24773278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University