View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5313_low_6 (Length: 292)
Name: NF5313_low_6
Description: NF5313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5313_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 109 - 285
Target Start/End: Complemental strand, 6246598 - 6246422
Alignment:
| Q |
109 |
aggtacaacaaccttagcttcttcattagtaaatggtttgattttgccaccatgaaagagttcttcagctgaacgagtcgacgatttatttgattcatgg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6246598 |
aggtacaacaaccttagcttcttcattagtaaatggtttgattttgccaccatgaaagagttcttcagctgaacgagtcgacgatttatttgattcatgg |
6246499 |
T |
 |
| Q |
209 |
ttaactgagaaagcaaaaccaccttggctatcatcatcttcatcaacaacgttgctgtttttgttgtttgatgatgt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6246498 |
ttaactgagaaagcaaaaccaccttggctatcatcatcttcatcaacaacgttgctgtttttgttgtttgatgatgt |
6246422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 15 - 51
Target Start/End: Complemental strand, 6246692 - 6246656
Alignment:
| Q |
15 |
atcttgaacttcttctaccagaattattcaatgatga |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6246692 |
atcttgaacttcttctaccagaattattcaatgatga |
6246656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University