View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5314-Insertion-3 (Length: 427)
Name: NF5314-Insertion-3
Description: NF5314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5314-Insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 215
Target Start/End: Complemental strand, 34567068 - 34566861
Alignment:
| Q |
8 |
ataagttgttttcattgactattatagacatgtcataggctgtttccgtgtggtcttataaacattctcacagttgcttttgatagtagataaactccga |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
34567068 |
ataaattgttttcattgactattatagacatgtcataggctgtttccgtgtggtcttataaacattctcacagttgcttttgatagtaaataaactccaa |
34566969 |
T |
|
| Q |
108 |
caagtcagtccacataaatcctaaatcagtgattactgattagcaagttcaaatacgcacaaacatagttgcagaattcactcaagtacccttagaacta |
207 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34566968 |
caagtcagtccaaataaatcctaaatcagtgattactgattagcaagttcaaatacacacaaacatagttgcagaattcactcaagtacccttagaacta |
34566869 |
T |
|
| Q |
208 |
attcgcgg |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
34566868 |
attcgcgg |
34566861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 215 - 270
Target Start/End: Complemental strand, 34566819 - 34566764
Alignment:
| Q |
215 |
ggaaaagaggcaaaactgttgccggtttatttgagcatgataatagctcaataaaa |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34566819 |
ggaaaagaggcaaaactgttgccggtttatttgagcatgacaatagctcaataaaa |
34566764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University