View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5314_high_10 (Length: 312)
Name: NF5314_high_10
Description: NF5314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5314_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 9 - 296
Target Start/End: Complemental strand, 34567352 - 34567065
Alignment:
| Q |
9 |
gagaagaagttggttagaatgtatgatggagataccggtgatgttggaggagagggtgatggtagtgatgaagtggatcaagtggttgttgggattttgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34567352 |
gagaagaagttggttagaatgtatgatggagataccggtgatgttggaggagagggtgatggtagtgatgaagtggatgaagtggttgttgggattttgc |
34567253 |
T |
|
| Q |
109 |
aggaagctgatgggaaaggaatggaaaggattgagatttcggatcggaaattgaaggtgttgccggaagcttttgggaggattcctggtttgcttgtgct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34567252 |
aggaagctgatgggaaaggaatggaaaggattgagatttcggatcggaaattgaaggtgttgccggaagcttttgggaggattcctggtttgcttgtgct |
34567153 |
T |
|
| Q |
209 |
tgacgcttctaagaatctgctttcggtaaagtgcttttctctactaatagtttctgatttacttaccgtgttttcatgtaagttataa |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34567152 |
tgacgcttctaagaatctgctttcggtaaagtgcttttcactactaatagtttctgatttacttacagtgttttcatgtaagttataa |
34567065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 95 - 143
Target Start/End: Complemental strand, 43237488 - 43237440
Alignment:
| Q |
95 |
tgttgggattttgcaggaagctgatgggaaaggaatggaaaggattgag |
143 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
43237488 |
tgttgggattatgcaggaagcggatgggaaaggaatggaacgaattgag |
43237440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 131
Target Start/End: Original strand, 7981379 - 7981415
Alignment:
| Q |
95 |
tgttgggattttgcaggaagctgatgggaaaggaatg |
131 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
7981379 |
tgttgggattatgcaggaagcagatgggaaaggaatg |
7981415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University