View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5314_high_16 (Length: 238)
Name: NF5314_high_16
Description: NF5314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5314_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 224
Target Start/End: Complemental strand, 32709756 - 32709540
Alignment:
| Q |
8 |
gtaaagaacacaatccacaagtatttgtattgttactaagtggtcgtctttaatgatgatgatcatcactgaatcactgttttctctcttttgctctttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32709756 |
gtaaagaacacaatccacaagtatttgtattgttactaagtggtcgtctttaatgatgatgatcatcactgaatcactgttttctctcttttgctctttc |
32709657 |
T |
|
| Q |
108 |
tcacaaccacaaagaagggaagcttctaatttctaatgccccctactcaagtgtgaaacttttttgtctgcaaatcttaataatcttctcataaatgatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32709656 |
tcacaaccacaaagaagggaagcttctaatttctaatgccccctactcaagtgtgaaacttttttgtctgcaaatcttaataatcttctcataaatgatt |
32709557 |
T |
|
| Q |
208 |
ggaacaagagaatttac |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32709556 |
ggaacaagagaatttac |
32709540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University