View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5314_low_18 (Length: 230)
Name: NF5314_low_18
Description: NF5314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5314_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 212
Target Start/End: Original strand, 32889155 - 32889347
Alignment:
| Q |
20 |
gggtgtacatgttttgcctacaatgaatgatcttgtatcgggtgtaatttgaaggacaaaatggataaactcaatctgaaatatcattgtcgcaatttgg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32889155 |
gggtgtacatgttttgcctacaatgaatgatcttgtatcgggtgtaatttgaaggacaaaatggataaactcaatctgaaatatcattgtcacaatttgg |
32889254 |
T |
 |
| Q |
120 |
acctcttgatgatccattgttgtctcttaaggtaccaaacataatagaaagaattatcttccaaagtttacataaaatatcattgaagaagaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32889255 |
acctcttgatgatccattgttgtctcttaaggtaccaaacataatagaaagaattatcttccaaactttacataaaatatcattgaagaagaa |
32889347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University