View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5314_low_4 (Length: 375)
Name: NF5314_low_4
Description: NF5314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5314_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 361
Target Start/End: Original strand, 46587856 - 46588217
Alignment:
| Q |
1 |
cgtgtgaatttagaggaggaaagtggcttgggagtgctgaacaaggtggtggtgaggggataaagattgagctgaatcagttgaagccttattactttgc |
100 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46587856 |
cgtgtgaatttagaggagcaaagttgcttggtagtgctgatcaaggtggtggtgaggggataaagattgagctgaatcaattgaagccttattactttgc |
46587955 |
T |
 |
| Q |
101 |
ctctgatgaaggtaatgcctatgactgtattgctggactcaccaagttcattgctgttccatctacacgttccttttaatttagccctcatggcccaatt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46587956 |
ctctgatgaaggcaatgcctatgactgtattgctggactcaccaagttcattgctgttccatctacacgttccttttaatttaaccctcatggcccaatt |
46588055 |
T |
 |
| Q |
201 |
gaatcaagttttttccttttaaggtagttgaattcaatatataaataaaatggatggtttcaatctgttttttctttcctgaagtatcgaaagnnnnnnn |
300 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
46588056 |
gaatcaagttatttccttttaaggtagttgaattcaaaatataaataaaatggatggtttccatctgttttttctttcctggagtatcgaaagaaaaaaa |
46588155 |
T |
 |
| Q |
301 |
nttatgttttttattgtggtttgtg-tacctagaaagaaatgatgatgtatttttgtctctg |
361 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| | | | ||||||||||||||||||||| |
|
|
| T |
46588156 |
attatgttttttattgtggtttgtgctacctagataaatacgatgatgtatttttgtctctg |
46588217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University