View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5314_low_8 (Length: 332)
Name: NF5314_low_8
Description: NF5314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5314_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 21 - 317
Target Start/End: Complemental strand, 46587656 - 46587360
Alignment:
| Q |
21 |
tcaaagtgattaaatataattaaatgcgttggtgtcgtgttagtgtcnnnnnnnnnnnnntgttaattgat-atgtgtgatgatacatacccaatgtgtc |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
46587656 |
tcaaagtgattaaatataattaaatgtgttggtgttgtgttagtgtcaaaaaacaaaaa-tgttaattgattatttgtgatgatacatacccaatgtgtc |
46587558 |
T |
 |
| Q |
120 |
atttatttggaaggggctatttttgatggcccattgagtgtagttagtgcctgcacgccaaccttcagagtctccaaccaagatgcttcttttggttccg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46587557 |
atttatttggaaggggctatttttgatggcccattgagtgtagttagtgcctgcacgccaaccttcagagtctccaaccaagatgcttcttttggttctg |
46587458 |
T |
 |
| Q |
220 |
gccttgcttcctgaccctgcaaccattgaagcaatcacaaggaagataactccttggattaaaattctagccatatgtttatgcatctttaattaatt |
317 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46587457 |
gccttgcttcttgaccctgcaaccattgaagcaatcacaaggaagataactccttggattaaaattctagccatatgtttatgcatctttaattaatt |
46587360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University