View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5315-Insertion-1 (Length: 276)
Name: NF5315-Insertion-1
Description: NF5315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5315-Insertion-1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 276
Target Start/End: Original strand, 5717226 - 5717488
Alignment:
| Q |
8 |
gattcagttaataatgacaacaaaaaccaaagctagttctctggtaaaacgtggacaaaagagaaacactcttttctatctttgtattttacacaaaata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5717226 |
gattcagttaataatgacaacaaaaaccaaagctagttctctggtaaaacgtggacaaaagagaaacactcttttctatctttgtattttacacaaaata |
5717325 |
T |
|
| Q |
108 |
tnnnnnnnngaaaagagactcaccttctattgtttttatatgaatgtgtgtgaccatttaatttatgatttcattgattccttttaggtcatgtgtaccc |
207 |
Q |
| |
|
| ||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5717326 |
taaa------aaaagggactcactttctattgtttttatatgaatgtgtgtgaccatttaatttatgatttcattgattccttttaggtcatgtgtaccc |
5717419 |
T |
|
| Q |
208 |
tcatgtttttatgtcacttatacagcctaaaacttgctattgctttgctgtttacatttgtgtcccata |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5717420 |
tcatgtttttatgtcacttatacagcctaaaacttgctattgctttgctgtttacatttgtgtcccata |
5717488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University