View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5315_high_10 (Length: 250)
Name: NF5315_high_10
Description: NF5315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5315_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 167 - 244
Target Start/End: Original strand, 10829113 - 10829190
Alignment:
| Q |
167 |
gtaaacctgagcatagactaatagttatttctgttttagttttatatttctatatagtttccttgtaaatattcttcg |
244 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10829113 |
gtaaacctgagcataggctaatagttatttttgttctagttttatatttctatatagtttccttgtaaatattgttcg |
10829190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 29969953 - 29969986
Alignment:
| Q |
178 |
catagactaatagttatttctgttttagttttat |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
29969953 |
catagactaatagttatttctgttctagttttat |
29969986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University