View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5315_high_12 (Length: 239)
Name: NF5315_high_12
Description: NF5315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5315_high_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 2552324 - 2552102
Alignment:
| Q |
17 |
acatttatgtgcataacaaaccataatgtgttaggatgttgattgttgatttatgaagtggtttatcttaccctacaatttcatgatcttgttccagatt |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2552324 |
acatttacctgcataacaaaccataatgtgttaggatgttaattgttgatttatgaagtggtttatcttaccctacaatttcatgatcttgttccagatt |
2552225 |
T |
|
| Q |
117 |
tatttacttggattggcaatcgcaatggcatttattcggctagctctagatacaaatggttgctcgaaaataatgtctctgcctcctaatatatcttggc |
216 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2552224 |
tatttacttggattggcaactgcaatggcatttattcggctagctctagatacaaatggttgctcgaaaataatgtctctgcctcctaatatatcttggc |
2552125 |
T |
|
| Q |
217 |
agtggtttggaaaaataagacat |
239 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
2552124 |
agtggtttggaaaaataggacat |
2552102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University