View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5315_low_11 (Length: 262)
Name: NF5315_low_11
Description: NF5315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5315_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 24932081 - 24932253
Alignment:
| Q |
1 |
ctgctatgttcctaagatggaacacatcaaaacaattatgtgtgggtgctacacagaaattaatatctttagagctctaaccgtgggagggttcccgtgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24932081 |
ctgctatgttcctaagatggaacacatcaaaacaattatgtatgggtgctacacagaaattaatatctttagagctctaaccgtgggagggttcccgtgc |
24932180 |
T |
|
| Q |
101 |
cctcgacatatccaagatataattttcttgactttcggctagcttgtccatccggtcatcattatctgttttt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24932181 |
cctcgacatatccaagatataattttcttgactttcggctagcttgtccatccggtcatcattatctgttttt |
24932253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 177 - 254
Target Start/End: Original strand, 24932365 - 24932442
Alignment:
| Q |
177 |
tactggcagcaaagttgtccttatgtcttgtacactttgatcctgatttgctcctttgtcaacattttcttctctgct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24932365 |
tactggcagcaaagttgtccttatgtcttgtacactttgatcctgatttgctactttgtcaacattttcttctctgct |
24932442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University