View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5315_low_16 (Length: 206)
Name: NF5315_low_16
Description: NF5315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5315_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 121 - 191
Target Start/End: Complemental strand, 5041996 - 5041925
Alignment:
| Q |
121 |
atgttccatcacttcca-cataaaagcctattatttttaccaatatattgcttcttcctactttctatagtg |
191 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5041996 |
atgttccatcacttccaacataaaagcctattttttttaccaatatattgcttcttcctactttctatagtg |
5041925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 5042116 - 5042057
Alignment:
| Q |
1 |
atataatatatagttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042116 |
atataatatatagttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
5042057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University