View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_high_19 (Length: 353)
Name: NF5316_high_19
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 54909440 - 54909282
Alignment:
| Q |
1 |
tcaatacttacgactttgcaccaaaataatttagatttccactgaccactgtaatgttaaattatcattgcttggatggatgctgcctatgttcctcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
54909440 |
tcaatacttacgactttgcaccaaaataatttagatttccactgaccactgtaatgttaaattatcattgcttggatggatgctgcttatgttcctcttt |
54909341 |
T |
 |
| Q |
101 |
agcttgtggcttattttcaatccaagcttcaccatgctagattataatcacgagtatgc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54909340 |
agcttgtggcttattttcaatccaagcttcaccatgctagattataatcacgagtatgc |
54909282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 187 - 334
Target Start/End: Complemental strand, 54909254 - 54909099
Alignment:
| Q |
187 |
ggcagttccggaatcttctacagtaa--------cttgaaagtcgaaatttaagtataggtatctattcgatttggcttctattacatattatacactta |
278 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54909254 |
ggcagttccggaatcttctacagtaatctgttcacttgaaagtcgaaatttaagtataggtatctattcgatttggcttctattacatattatacactta |
54909155 |
T |
 |
| Q |
279 |
ataaatatactatttatcatctgaaagggagaagtgatataaaattgcgacgttga |
334 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54909154 |
ataaataaactatttattatctgaaagggagaagtgatataaaattgcgacgttga |
54909099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University