View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5316_high_28 (Length: 258)

Name: NF5316_high_28
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5316_high_28
NF5316_high_28
[»] chr1 (2 HSPs)
chr1 (1-76)||(36416131-36416206)
chr1 (143-183)||(36416025-36416065)


Alignment Details
Target: chr1 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 36416206 - 36416131
Alignment:
1 aaataaaaatacaatgttggataacttttggaacgttcaaacaacttttctagttaaagaatcgtattcccaccca 76  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
36416206 aaataaaaatacaatgttggataacttttggaatgttcaaacaacttttctagttaaagaatcgtattcccaccca 36416131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 143 - 183
Target Start/End: Complemental strand, 36416065 - 36416025
Alignment:
143 gatgaatcaatattaatgaactaagtatgcgaatatttttg 183  Q
    |||||||||||||||||||||||||||||||||||||||||    
36416065 gatgaatcaatattaatgaactaagtatgcgaatatttttg 36416025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University