View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_high_36 (Length: 222)
Name: NF5316_high_36
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 9 - 206
Target Start/End: Original strand, 5525367 - 5525564
Alignment:
| Q |
9 |
cgaagaatattacaatgttgaaagctttggttgagagaaagagtgtgaagaggaagtcattggagttgaagatgaagatggagactaaggtggaggctaa |
108 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5525367 |
cgaagaatactacgatgttgaaagctttggttgagagaaagagtgtgaagaggaagtcattggagttgaagatgaagatggagactaaggtggaggctaa |
5525466 |
T |
|
| Q |
109 |
gatgtgggttttcaagactccacgtgttggaatcaatgtgctttgtgacggtatcgatgtcgccggcgagaaagtgacgacggcagatgagaagtgtg |
206 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5525467 |
gatgtgggttttcaagactccacatgttggaataaatgtgctttgtgacggtatcgatgtcgccggcgagaaagtgacgacggcggatgagaagtgtg |
5525564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University