View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_high_38 (Length: 205)
Name: NF5316_high_38
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_high_38 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 43 - 205
Target Start/End: Complemental strand, 38003505 - 38003343
Alignment:
| Q |
43 |
ggtcaatcttggtcatgatccgagctttatttgggtagcatttacacttcacacgaggtcgtggtcaagggaggtttaagatagcgaatgagggatgaga |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38003505 |
ggtcaatcttggtcatgatccgagctttatttgggtagcattcacacttcacacgaggtcgtggtcaagggaggtttaagatagcgaatgagggatgaga |
38003406 |
T |
|
| Q |
143 |
ggaaaataaatgtgttgcaagatgcatggttaggggagcaagataattcttttgttactaacc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38003405 |
ggaaaataaatgtgttgcaagatgcatggttaggggagcaagataattcttttgttactaacc |
38003343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University